Revista Bioreview Edición 123 - Noviembre 2021

BIODIAGNOSTICO
MANLAB
fba

 

Variabilidad de la expresión de las distintas Isoformas del receptor de prolactina en células del sistema inmunológico en pacientes con Lupus Eritematoso Sistémico

Miralles, MD1, Moreno Sosa MT2, Sánchez MB2, Bittar V3, Rivero MG3, Pedrosa P3, Jahn GA2, Valdez SR2, Mackern-Oberti, JP2,#.

1Htal Español Mza; 2 IMBECU-UNCuyo; 3 Hospital Central Mza.

 

E-mail: jpmackern@conicet-mendoza.gob.ar y daniela_miralles02@hotmail.com

 

# Correspondence: Dr. Juan Pablo Mackern-Oberti, Instituto de Medicina y Biología Experimental de Cuyo - CCT-CONICET Mendoza, Argentina. Av. Ruiz Leal s/n, CP5500, Mendoza, Argentina. Email: jpmackern@mendoza-conicet.gob.ar. Tel.: +542615244156.

Resumen 

La identificación de nuevos mecanismos moleculares involucrados en el desarrollo de enfermedades autoinmunes permitirá elaborar nuevas herramientas clínicas para un correcto diganóstico y seguimiento junto con el diseño de terapias personalizadas que sean más efectivas, que reduzcan la respuesta autorreactiva y resguarden la competencia del sistema inmune. La alta incidencia de enfermedades autoinmunes sobre el sexo femenino, especialmente Lupus Eritematoso Sistémico (LES) indica fuertemente que, siendo las hormonas femeninas un factor clave en la diferenciación fenotípica de los diferentes géneros cromosómicos, éstas podrían estar involucradas en los mecanismos autoinmunes subyacentes y ser un factor de riesgo considerable. Diversos estudios indican que existe una asociación entre hiperprolactinemia y LES sugiriendo así un rol importante de prolactina (PRL) en estos trastornos. Las acciones de PRL están mediadas por su receptor (PRL-R) que puede tener diferentes isoformas incluyendo una isoforma larga (PRL-RL) activadora formada por un dominio extracelular, uno transmembrana y uno transductor de señales intracelulares. La isoforma corta (del inglés “Short 1 b” PRL-RS1b) carece del dominio citoplasmático y por consiguiente no posee señalización intracelular. Las isoformas PRL-RS1b y PRL-RL se encuentran co-expresadas en diferentes tejidos incluyendo órganos linfáticos. Aunque la regulación de las diferentes isoformas del PRL-R ha sido estudiada extensivamente en el tracto reproductor femenino, su expresión en células del sistema inmune es indiscutiblemente desconocida. Debido a que alteraciones en la activación de linfocitos T podrían contribuir al desarrollo de autoinmunidad, la identificación de nuevos blancos terapéuticos relacionados con estas células es de vital importancia para el diseño de nuevas terapias y marcadores pronósticos de la enfermedad. Con estos antecedentes, el objetivo de nuestro trabajo fue evaluar el potencial del estudio de la expresión de ARNm del PRL-R en la enfermedad lúpica enrolando pacientes femeninos en distintas fases de la enfermedad. En este trabajo evaluamos mediante PCR en tiempo real la expresión de ARNm de las diferentes isoformas del PRL-R en células inmunes de sangre periférica de pacientes lúpicos del sexo femenino. Además, correlacionamos los valores obtenidos de la expresión del PRL-R con la severidad de la enfermedad. Logramos identificar exitosamente la presencia de PRL-RS1b y PRL-RL en las muestras de pacientes e individuos saludables. Sin embargo, la abundancia de ARNm de ambas isoformas no resultó en diferencias significativas entre pacientes e individuos saludables del grupo control. Los datos arrojados en este proyecto contribuyen a la comprensión de las interacciones entre el sistema inmune y endócrino en la salud y en la enfermedad en donde nuestro aporte indica que los niveles de PRL-R no cambiarían sustancialmente en la enfermedad lúpica. Además, el éxito del proyecto a largo plazo también contribuirá a la salud pública con el desarrollo de nuevos conocimientos sobre una descripción molecular del PRL-R enfocado en la prognosis de LES.

Objetivo general 

Evaluar el estudio del ARNm de las isoformas del PRL-R como herramienta clínica para el seguimiento y prognosis de LES.

Teniendo en cuenta que aún no se han desarrollado terapias completamente eficientes y junto con la necesidad de mejorar las herramientas clínicas para el tratamiento de trastornos autoinmunes nos proponemos desarrollar los siguientes objetivos específicos:

Objetivo específico 1.

Estudiar la expresión ex vivo de ARNm de las diferentes isoformas del PRL-R en células del sistema inmune de pacientes con Lupus Eritematoso Sistémico, obtenidas de sangre periférica

Objetivo específico 2.

Evaluar y correlacionar los niveles de expresión de ambas isoformas del receptor de prolactina con la severidad de la enfermedad.

Hipótesis:

La expresión de ARNm de las isoformas del PRL-R en células del sistema inmune de pacientes con LES presenta diferencias en sus niveles de expresión comparados con individuos sanos.

Materiales y métodos

Pacientes

Para el desarrollo de los objetivos específicos se reclutaron individuos pertenecientes a un grupo control y un grupo LES según las siguientes especificaciones de inclusión:

Grupo control: compuesto por 5 pacientes control. Los mismos serán pacientes sanos, de sexo femenino. Con edades comprendidas entre los 20 y los 65 años. Sin enfermedades conocidas y que no estén realizando ningún tratamiento farmacológico. Se excluyeron mujeres embarazadas, menopaúsicas o en periodo de lactancia.

Grupo LES: compuesto por 9 pacientes con LES, de sexo femenino, que asisten al servicio de reumatología y enrolados por médicos pertenecientes al Instituto de Inmunologia del Hospital Central de Mendoza.

Criterios de Inclusión para grupo LES:

1. Mayores de 18 años y menores de 65 años

2. Pacientes que cumplan con los criterios revisados del American College of Rheumatology para el diagnóstico del Lupus Eritematoso Sistémico y Artritis Reumatoide

3. Pacientes que a criterio del reumatólogo tratante tenga enfermedad “clínicamente estable” que haga poco probable la necesidad de ajuste de dosis de esteroides o cualquier inicio de un nuevo tratamiento inmunosupresor durante el curso del estudio o ambos

4. Inicio de la enfermedad al menos 6 meses antes de la inclusión en el estudio

5. Enfermedad activa con SLEDAI-2k >= 6

6. Uso de hidroxicloroquina dosis estable por 3 meses

7. Uso de micofenolato o Azatioprina o metotrexate estable

8. En el caso de mujeres en edad fértil se consultará sobre el uso de método anticonceptivo.

Criterios de Exclusión para grupo LES:

1. Diagnóstico concomitante de otra enfermedad autoinmune como, pero no exclusivamente, Esclerosis Múltiple, Diabetes Mellitus tipo 1, Esclerodermia, Artritis Idiopática Juvenil

2. Diagnóstico concomitante de alguna enfermedad crónica como, pero no exclusivamente, Diabetes Mellitus tipo 2, Insuficiencia Renal Crónica, Cirrosis Hepática, Síndrome de Inmunodeficiencia Adquirida, tumores sólidos y/o neoplasias hematológicas, Insuficiencia Cardiaca, Limitación Crónica del Flujo Aéreo

3. Embarazo o intención de embarazo en el año del estudio

4. Manifestaciones de enfermedad que a juicio del los investigadores sean graves y hagan que sea inapropiado el ingreso al estudio. Ejemplos: vasculitis del sistema nervioso central, psicosis lúpica, nefritis lúpica activa, trombocitopenia < 50.000, Hb< 8 gr/dL Leucopenia <3000, linfopenia< 400

5. Manifestaciones de enfermedad que amenacen la vida

6. Uso de dosis de prednisona> 30 mg diarios

7. Uso de terapia biológica en los 6 meses previos a la visita basal. Se excluye la ciclosporina, clorambucil, ciclofosfamida en los 6 meses anteriores

8. Infecciones graves (uso de antibióticos iv, oportunistas, tuberculosis latente, herpes zoster) seis meses antes de la visita basal

9. Niveles de Inmunoglobulinas plasmáticas bajo lo normal

10. Pruebas hepáticas > 3 veces el normal. Electrocardiograma anormal o radiografía de tórax anormal

11. Uso de terapia anticoagulante o síndrome antifosfolipidos asociado con LES

12. Haber recibido vacunas a virus atenuado durante el último año

13. Tener VIH, VHB y/o VHC

Bioética y bioseguridad

Los pacientes fueron comunicados de forma simple sobre el estudio para asegurar su correcta comprensión. Se les ha informado sobre la utilización de los datos del estudio y han firmado un consentimiento informado en forma individual. Los protocolos y el documento consentimiento informado desarrollados en el presente proyecto se encuentran aprobados por el comité de bioética de la Facultad de Ciencias Médicas de la UNCuyo y el comité de docencia e investigación del Hospital Central Mendoza. De la misma manera, todas los mecanismos de procesamiento de las muestras cuentan con estricta supervisión de protocolos de bioseguridad.

Obtención de células mononucleares de sangre periférica

Se obtuvo 20 mL de sangre periférica anticoagulada con EDTA. Se separaron células mononucleares de sangre periférica (PBMC en inglés) por el método de Ficoll-Hypaque convencional. La sangre obtenida fue diluida a la mitad con solución fisiológica estéril obteniendo una suspensión celular de 40 mL. Posteriormente, 10 mL de sangre fue vertida suavemente sobre 3 mL de Ficoll-Hypaque colocado previamente en un tubo cónico estéril de 15 mL. Este procedimiento se realizó en 4 tubos en forma simultánea. Posteriormente, los tubos fueron centrifugados por 20 min a 1800 rpm a temperatura ambiente. Al finalizar, la células mononucleares se encuentran en una capa intermedia del tubo de 15 mL. Estas células son aspiradas en forma cuidadosa mediante la utilización de pipetas pasteur estériles de 3 mL y depositadas en un tubo nuevo de 15ml. Las células obtenidas son lavadas con solución fisiológica y centrifugadas para descartar los residuos del Ficoll-Hypaque. De esta manera se obtienen aproximadamente 4*106 células/mm3.

ARN y ADNc

Las células obtenidas fueron procesadas para obtener y purificar ARN utilizando el reactivo de TRIZOL (Invitrogen). Esta técnica se fundamenta en una primera extracción con solvente orgánico y luego su precipitación con isopropanol. Posteriormente 2 microgramos de ARN total fueron utilizados para sintetizar ADNc utilizando la enzima MMLV transcriptasa reversa y oligodT como primers específicos para ARNm (poli A) totales según las especificaciones de reacción del comerciante.

PCR en Tiempo Real

Se realizaron ensayos de PCR en tiempo real para la cuantificación de mRNA de las diferentes isoformas del PRL-R. Los mismos se llevaron a cabo en el equipo Corbett 6000 (Quiagen, Inc) utilizando tres réplicas técnicas por cada muestra ensayada). La abundancia de los niveles de expresión de ARNm se realizó mediante el análisis de 2(-ΔΔCt) utilizado ampliamente para una comparación de abundancia de ARNm entre dos grupos utilizando como gen de referencia (o housekeeping gene) al gen de actina. Las secuencias utilizadas fueron: ACTINA humana Fw AAAGACCTGTACGCCAACAC y Rv GTCATACTCCTGCTTGCTGAT; PRL-RL Fw CCTTGTCCAGGTTCGCTGCAAA y Rv AGATGAGCATCAAATCCTTTTA; PRL-R1b (corto) Fw TAAATGGTCTCCACCTACCCTGAT y Rv CACCTCCAACAGATGAGCATCAAATCC. Los ciclos utilizados fueron de 3 pasos utilizando 95° 30seg-60° 30seg-72° 30seg en los 3 genes estudiados. Los productos generados por las PCR fueron secuenciados previamente para corroborar la identidad de los mismos y que correspondan específicamente con las secuencias del PRL-R. Los datos obtenidos fueron analizados con el programa GraphPad y Microsoft Excel.

Marco teórico del tema en estudio y antecedentes

Durante muchos años se han reportado numerosos avances en relación a los mecanismos patogénicos de las enfermedades autoinmunes 1, 2. Sin embargo, aún no se han desarrollado terapias específicas y eficaces para trastornos autoinmunes sistémicos como el Lupus Eritematoso Sistémico (LES) o Artritis Reumatoide (AR)3, 4. La gran heterogeneidad que rodea todos los ámbitos de las enfermedades autoinmunes como su prognosis, diagnóstico, tratamiento y etiología perjudica el desarrollo de nuevas terapias 5. A pesar de numerosos esfuerzos enfocados en la búsqueda de terapias más eficaces para las enfermedades autoinmunes sistémicas, la mayoría de las terapias actuales se fundamentan en la administración de drogas inmunosupresoras conduciendo a una supresión generalizada que puede llevar a severas complicaciones 6. Debido a esto, es crucial identificar mecanismos patogénicos en el desarrollo de autoinmunidad en forma individualizada así permitiendo diseñar terapias inmunosupresoras personalizadas que resguarden la competencia del sistema inmune.

Actualmente, se postula que múltiples factores intervienen en el desencadenamiento de las enfermedades autoinmunes incluyendo componentes genéticos, ambientales, infecciosos y hormonales que confieren una mayor susceptibilidad o mayor riesgo pero no aseguran su desarrollo 7-9. La alta incidencia de enfermedades autoinmunes sobre el sexo femenino respecto del masculino sugiere que la homeostasis hormonal del género femenino es un factor de riesgo muy importante 10. 

En los últimos años se ha avanzado mucho en el conocimiento del rol modulador de PRL sobre el sistema inmune 11-13. Se ha realizado aportes científicos sobre el rol de PRL en la regulación del sistema inmune demostrando que niveles de PRL disminuidos durante la lactancia disminuyen la cantidad de linfocitos T presentes en glándula mamaria 14. 

Estudios indican que en el timo PRL tendría un rol sobre la diferenciación de linfocitos T promoviendo la sobrevida de timocitos CD4-CD8- y su diferenciación a timocitos CD4+CD8+15. PRL participa en la activación de linfocitos T, principalmente incrementando su intensidad 16, 17, y aumentando la respuesta proliferativa de linfocitos T frente a mitógenos como así también la producción de IL-2 18.

Adicionalmente, PRL posee efectos antiapoptóticos sobre linfocitos B con un aumento en la producción de anticuerpos 12, 19. En células dendríticas, PRL aumenta la expresión de MHCII y CD40, y la producción de IL6 e IL12, promoviendo así su capacidad estimuladora de linfocitos T 20. 

La síntesis y secreción principal de PRL es un proceso complejo que se produce en las células lactotropas de la glándula pituitaria anterior (o hipófisis), y que está bajo el control de múltiples factores estimuladores e inhibidores 21. La dopamina secretada por neuronas hipotalámicas es el principal regulador negativo de la secreción de PRL pituitaria, actuando sobre el receptor de dopamina D2 en la membrana de las células lactotropas 22. PRL ejerce un efecto de retroalimentación negativa indirecta sobre su propia secreción actuando sobre neuronas hipotalámicas dopaminérgicas 21. Se ha demostrado también que PRL puede producirse en numerosos tejidos extrapituitarios, tales como decidua, glándula mamaria, ovario, próstata, testículo, linfocitos, células endoteliales, cerebro, piel, folículos pilosos, tejido adiposo y cóclea pero su función a estos niveles todavía no está bien esclarecida 21-23.

Se ha reportado una asociación entre hiperprolactinemia (hiperPRL) y enfermedades autoinmunes sistémicas (LES y AR), como así también con enfermedades autoinmunes específicas de órgano (Diabetes Mellitus tipo I, Tiroiditis de Hashimoto y Esclerosis Múltiple) 24-27. Para el caso de LES, estudios pre-clínicos indican que una hiperPRL se correlacionaría con el grado de actividad de la enfermedad y con títulos elevados de autoanticuerpos 26; sin embargo otros estudios no lograron encontrar la misma asociación 25. En cambio, en modelos animales de LES se observó una correlación marcada entre los niveles de PRL circulante y la severidad de la enfermedad 11, 19. Estudios pre-clínicos han reportado que el tratamiento con inhibidores de la liberación de PRL disminuye el número de recaídas en pacientes con LES, sugiriendo así un rol importante de PRL en el desarrollo de autoinmunidad28. Los mecanismos por los cuales una hiperPRL se asociaría al desarrollo de autoinmunidad no se conocen claramente y por ello es importante avanzar en el estudio de los efectos de PRL sobre linfocitos T.

Las acciones de PRL están mediadas por su receptor 29, el cual está formado por un dominio extracelular, un dominio transmembrana y un dominio transductor de señales intracelular altamente conservado entre especies 30. El gen del PRL-R contiene diferentes exones que por empalmes alternativos pueden generar diversas isoformas. Estas isoformas poseen un dominio extracelular idéntico, pero difieren en el tamaño y la secuencia de la porción intracelular, que puede ser corta, larga o intermedia presentando algunas diferencias entre humano y murino 31. La isoforma corta del PRL-R (PRL-RC) carece del dominio citoplasmático y por consiguiente no posee señalización intracelular 31. La isoforma larga del PRL-R (PRL-RL) se dimeriza en forma constitutiva y luego de la unión de una sola molécula del ligando (PRL) transmite una señal a través de proteínas citoplasmáticas asociadas 32. Por otro lado, heterodímeros de PRL-RL y PRL-RS1b son funcionalmente inactivos y no pueden conducir la transmisión de señales 33. Además de las diferentes isoformas unidas a la membrana, podemos encontrar una isoforma soluble del PRL-R (PRL-RS) constituida por la porción extracelular 34.

En la lactogénesis, el señalamiento del PRL-RL en glándula mamaria e hígado es diferente. De forma similar, la expresión de ARNm del PRL-RL se encuentra regulado de manera diferencial entre hígado y glándula mamaria 35, 36.

Las isoformas PRL-RC y PRL-RL se encuentran co-expresadas en diferentes tejidos incluyendo órganos linfáticos como timo y bazo, siendo la isoforma PRL-RL la más expresada 37, 38. Utilizando anticuerpos contra el dominio extracelular del PRL-R que se unen a ambas isoformas indistintamente, se ha demostrado que monocitos, macrófagos, células dendríticas, linfocitos T CD4+, T CD8+, Tγδ, linfocitos B, NK, granulocitos y células epiteliales tímicas expresan el PRL-R 15, 38-40. La regulación de las diferentes isoformas del PRL-R y su activación han sido estudiadas principalmente en el tracto reproductor femenino y glándula mamaria 41, estando reguladas por mecanismos endócrinos, parácrinos y autócrinos mediados por hormonas del ciclo ovárico 37. Por el contrario, la modulación de PRL-RL y PRL-RS1b en linfocitos T durante enfermedades autoinmunes es completamente desconocida. Debido a que alteraciones en la activación y señalización de linfocitos T puedan contribuir al desarrollo de enfermedades autoinmunes, la identificación de nuevos blancos terapéuticos linfocitarios es de vital importancia para el diseño de tratamientos eficaces como así también la generación de nuevos marcadores pronósticos de la enfermedad 42.

Se podría especular entonces que debido a fallas en la regulación de la expresión del PRL-RS1b, el cual carece de señalamiento, conduciría a un menor efecto sobre la modulación de la activación mediada por PRL y PRL-RL durante la activación de linfocitos T. En individuos susceptibles, estas fallas en la regulación podrían favorecer el inicio y la progresión de patologías autoinmunes. Por el contrario, la inducción farmacológica del PRL-RS1b podría suprimir respuestas inflamatorias exacerbadas siendo una potencial estrategia terapéutica para las enfermedades autoinmunes.

Resultados

Para evaluar la expresión de ARNm de las dos isoformas principales del PRL-R en células inmunes de pacientes autoinmunes y valuar su potencial uso como biomarcador, iniciamos un estudio clínico descriptivo no intervencionista. Enrolamos a pacientes mujeres con LES y mujeres saludables. No se incluyeron hombres en el estudio. Se obtuvieron 14 muestras de sangre periférica, donde 5 pertenecieron a mujeres saludables denominado grupo control; y 9 muestras provenientes de pacientes con LES. La totalidad de las muestras corresponde al sexo femenino. La edad promedio de las mujeres que conformaron el grupo de pacientes con LES fue de 31 años, con un límite superior de 41 años y un límite inferior de 19 años (Tabla 1). La duración de la enfermedad al momento de la toma de muestra fue en promedio de 5,1 años. En cuanto a las manifestaciones clínicas de la enfermedad dentro del grupo estudiado ningún paciente presentaba fiebre, mialgias, miositis, disminución de peso o úlceras orales. En la figura número 1 se observa el porcentaje de pacientes con las principales manifestaciones clínicas presentes en LES.

En base a los datos clínicos obtenidos podemos concluir que nuestra población en estudio se comporta de forma similar a lo reportado por numerosos estudios donde la heterogeneidad clínica es muy marcada 43. 

De forma similar, los parámetros de laboratorio de los pacientes con LES también fueron similares a lo reportado previamente al momento de la extracción de la muestra 44. La figura 2 muestra el porcentaje de pacientes con cada una de las principales alteraciones bioquímicas. La totalidad de los pacientes presentaba Anticuerpos anti-nucleares (ANA) positivos. Si bien un pequeño porcentaje presentaba proteinuria, no presentaban alteraciones del índice de filtrado glomerular al momento del estudio.

Teniendo en cuenta que nuestra cohorte de pacientes se comportaba de una manera esperada se procedió a continuar con los análisis de ARNm específico para PRL-R. 

Posteriormente evaluamos la expresión de ARNm de las diferentes isoformas del PRL-R por PCR en tiempo real en las muestras de PBMC de nuestra cohorte de pacientes con Lupus siguiendo los protocolos descriptos en materiales y métodos. Los resultados obtenidos indican que PBMC expresan ambas isoformas del PRL-RL y S1b, y que éstas se pueden cuantificar exitosamente como se puede observar en la figura 3 donde se evidencian las curvas de amplificación de PRL-RL.

Al analizar la expresión de las diferentes isoformas del PRL-R no se evidencian diferencias significativas entre las medias de los pacientes con LES en comparación con las mujeres saludables encontradas en el grupo control. 

A continuación se presenta una tabla con las medidas estadísticas más importantes obtenidas del procesamiento de los datos de la expresión de ambas isoformas del PRL-R en células PBMC en los dos grupos de pacientes estudiados.

Posteriormente se determinó si la expresión de las isoformas del PRL-R se asocia con la actividad de la enfermedad y su duración para así evaluar su potencial como biomarcador en la prognosis y tratamiento de LES. Determinamos mediante un análisis de correlación de Spearman entre la expresión de PRL-RL (Figura 4 A y D), o PRL-RS1b (Figura 4 B y E), o PRL-RL/PRL-RS1b (Figura 4 C y F), y la actividad utilizando el índice SLEDAI, o duración de la enfermedad. Como se puede observar en la figura 5, no logramos identificar ninguna correlación estadísticamente significativa (r>0,69; p>0,05). Se evidencian tendencias positivas entre los niveles de las diferentes isoformas, actividad y duración.

Por el contrario a lo que habíamos evidenciado sobre un aumento en la razón PRL-RL/PRL-RS1b en los pacientes con LES respecto al grupo control, este índice no mostró correlación alguna con SLEDAI y duración (Figura 4 C y F). Con este análisis podemos llegar a la conclusión de que no existe evidencia muestral suficiente para demostrar una asociación entre la expresión relativa de las distintas isoformas del PRLR con la duración de la enfermedad en pacientes con LES. La figura número 5, lo demuestra gráficamente.

Discusión

Los presentes resultados demuestran que células inmunes de sangre periférica expresan transcriptos de PRL-RL y PRL-RS1b y que éstos se pueden cuantificar exitosamente. Estos hallazgos son similares a reportes de los últimos años donde se demuestra la expresión de PRL-RL en células inmunes 45. Sin embargo, la expresión de la isoforma corta en células inmunes todavía es un tema de debate. Para nuestro conocimiento, este es un resultado inédito donde logramos cuantificar de manera exitosa los niveles de ARNm del PRL-RS1b. Sin embargo, no se encontró una correlación entre la expresión de las diferentes isoformas y la actividad de la enfermedad o el tiempo de duración de la misma. Esto último es un hallazgo original que ayudará a comprender la regulación de la transcripción de genes relacionados con el sistema PRL / PRL-R y su impacto en la sintomatología del lupus.

En nuestro trabajo demostramos que PBMC provenientes de nuestro grupo de pacientes con LES no presenta diferencias en la expresión de ARNm de PRL-RL, o PRL-RS1b, comparado con mujeres saludables. Por el contrario, está reportado que Linfocitos T efectores de pacientes con LES presentan diferencias en la expresión de PRL-RL comparado con individuos saludables 45. Esta falta de concordancia entre nuestro trabajo y la de Legorreta y col (2016) podría deberse a la utilización de diferentes muestras. En nuestro caso utilizamos células mononucleares que incluyen linfocitos (B, T, Treg y NK) y monocitos, mientras que en el trabajo citado utilizan linfocitos T efectores purificados. Sin embargo, la utilización de un índice PRL-RL/PRL-RS1b para identificar posibles alteraciones en el sistema PRL - PRL-R en muestras de pacientes con LES podría ser utilizado en el futuro.

Legorreta y col también evidenciaron que los niveles de PRL-RL están asociados a la severidad de la enfermedad45. Por el contrario, en nuestro trabajo no logramos identificar una correlación entre los niveles de PRL-RL, o PRL-RS1b, y la severidad de la enfermedad. Sin embargo se observa una tendencia positiva entre los niveles de PRL-RL, como así también de PRL-RS1b, con la actividad de la enfermedad simulando lo observado por Legorreta (2016). La falta de significancia estadística podría deberse a que nuestra cohorte de pacientes es más pequeño que el descripto por Legorreta 45. Adicionalmente evaluamos la correlación entre PRL-RL, PRL-RS1b y la duración de la enfermedad. De forma similar a lo observado con el SLEDAI, no se encontró correlación alguna.

Conclusiones

Para nuestro conocimiento, este es el primer reporte donde se evalúa una correlación entre PRL-RS1b, SLEDAI y duración. De forma similar, el estudio de la expresión de las isoformas del PRL-R en las diferentes poblaciones linfocitarias purificadas es crucial para continuar con nuestro estudio. En resumen, los datos que nacen de nuestro estudio no evidencian una gran ventaja en la utilización del estudio de las diferentes isoformas del PRL-R como marcador de LES. Sin embargo, la utilización del índice PRL-RL/PRL-RS1b podría colaborar en una futura clasificación detallada de los pacientes con LES aunque en este estudio no logramos asociar la expresión de las isoformas con parámetros clínicos de la enfermedad. El estudio de la expresión de PRL-R como así también parámetros epigenéticos relacionados a la regulación de su transcripción en poblaciones leucocitarias purificadas podría resultar más eficiente y clínicamente relevante.

 

 

1. Gratz IK, Rosenblum MD, Maurano MM, Paw JS, Truong HA, Marshak-Rothstein A, Abbas AK. Cutting Edge: Self-Antigen Controls the Balance between Effector and Regulatory T Cells in Peripheral Tissues. J Immunol 2014; 192:1351-5.

2. Oftedal B, Hellesen A, Erichsen M, Bratland E, Vardi A, Perheentupa J, Kemp E, Fiskerstrand T, Viken M, Weetman A, Fleishman S, Banka S, Newman W, Sewell W, Sozaeva L, Zayats T, Haugarvoll K, Orlova EM, Haavik J, et al. Dominant Mutations in the Autoimmune Regulator AIRE Are Associated with Common Organ-Specific Autoimmune Diseases. Immunity 2015; 42:1185-96.

3. Hahn BH. Belimumab for Systemic Lupus Erythematosus. N Eng J Med 2013; 368:1528-35.

4. Suurmond J, Zou YR, Kim SJ, Diamond B. Therapeutics to block autoantibody initiation and propagation in systemic lupus erythematosus and rheumatoid arthritis. Sci Transl Med 2015; 7:280-5.

5. Li PH, Wong WHS, Lee TL, Lau CS, Chan TM, Leung AMH, Tong KL, Tse NKC, Mok CC, Wong SN, Lee KW, Ho MHK, Lee PPW, Chong CY, Wong RWS, Mok MY, Ying SKY, Fung SKS, Lai WM, et al. Relationship between autoantibody clustering and clinical subsets in SLE: cluster and association analyses in Hong Kong Chinese. Rheumatology 2013; 52:337-45.

6. Houssiau F, Ginzler E. Current treatment of lupus nephritis. Lupus 2008; 17:426-30.

7. Ganesh BB, Bhattacharya P, Gopisetty A, Prabhakar BS. Role of Cytokines in the Pathogenesis and Suppression of Thyroid Autoimmunity. J Interferon Cytokine Res 2011; 31:721-31.

8. Tomer Y, Huber A. The etiology of autoimmune thyroid disease: A story of genes and environment. J Autoimmun 2009; 32:231-9.

9. Martin WJ, Steer AC, Smeesters PR, Keeble J, Inouye M, Carapetis J, Wicks IP. Post-infectious group A streptococcal autoimmune syndromes and the heart. Autoimmun Rev 2015; 14:710-25.

10. Østensen M, Andreoli L, Brucato A, Cetin I, Chambers C, Clowse MEB, Costedoat-Chalumeau N, Cutolo M, Dolhain R, Fenstad MH, Förger F, Wahren-Herlenius M, Ruiz-Irastorza G, Koksvik H, Nelson-Piercy C, Shoenfeld Y, Tincani A, Villiger PM, Wallenius M, et al. State of the art: Reproduction and pregnancy in rheumatic diseases. Autoimmun Rev 2015; 14:376-86.

11. Venkatesh J, Peeva E, Xu X, Diamond B. Cutting Edge: Hormonal Milieu, Not Antigenic Specificity, Determines the Mature Phenotype of Autoreactive B Cells. J Immunol 2006; 176:3311-4.

12. Peeva E, Michael D, Cleary J, Rice J, Chen X, Diamond B. Prolactin modulates the naive B cell repertoire. J Clin Invest 2003; 111:275-83.

13. Ben-Jonathan N, LaPensee CR, LaPensee EW. What Can We Learn from Rodents about Prolactin in Humans? Endocr Rev 2008; 29:1-41.

14. Mackern-Oberti JP, Valdez SR, Vargas-Roig LM, Jahn GA. Impaired mammary gland T cell population during early lactation in hypoprolactinemic lactation-deficient rats. Reproduction 2013; 146:233-42.

15. De Mello-Coelho V, Savino W, Postel-Vinay M-C, Dardenne M. Role of Prolactin and Growth Hormone on Thymus Physiology. Dev Immunol 1998; 6.

16. Takizawa K, Kitani S, Takeuchi F, Yamamoto K. Enhanced Expression of CD69 and CD25 Antigen on Human Peripheral Blood Mononuclear Cells by Prolactin. Endocr J 2005; 52:635-41.

17. Chavez-Rueda K, Hérnández J, Zenteno E, Leaños-Miranda A, Legorreta-Haquet MV, Blanco-Favela F. Identification of prolactin as a novel immunomodulator on the expression of co-stimulatory molecules and cytokine secretions on T and B human lymphocytes. Clin Immunol 2005; 116:182-91.

18. Xu D, Lin L, Lin X, Huang Z, Lei Z. Immunoregulation of autocrine prolactin: Suppressing the expression of costimulatory molecules and cytokines in T lymphocytes by prolactin receptor knockdown. Cell Immunol 2010; 263:71-8.

19. Legorreta-Haquet MV, Flores-Fernandez R, Blanco-Favela F, Fuentes-Panan EM, Chavez-Sanchez L, Hernandez-Gonzalez R, Tesoro-Cruz E, Arriaga-Pizano L, vez-Rueda AK. Prolactin Levels Correlate with Abnormal B Cell Maturation in MRL and MRL/lpr Mouse Models of Systemic Lupus Erythematosus-Like Disease. Clin Dev Immunol 2013; 2013:11.

20. Yang L, Hu Y, Li X, Zhao J, Hou Y. Prolactin modulates the functions of murine spleen CD11c-positive dendritic cells. Int Immunopharmacol 2006; 6:1478-86.

21. Grattan DR, Kokay IC. Prolactin: A Pleiotropic Neuroendocrine Hormone. J Neuroendocrinol 2008; 20:752-63.

22. Bernard V, Young J, Chanson P, Binart N. New insights in prolactin: pathological implications. Nat Rev Endocrinol 2015; 11:265-75.

23. Ben-Jonathan N, Mershon J, Allen D, Steinmetz R. Extrapituitary Prolactin: Distribution, Regulation, Functions, and Clinical Aspects. Endocr Rev 1996; 17:639-69.

24. Paraiba D, Soares C, Bartolini P, Arthuso F, Borba E, Bonfa E, Bronstein M. Lymphocytic prolactin does not contribute to systemic lupus erythematosus hyperprolactinemia. Clin Exp Rheumatol 2010; 28:0866-72.

25. Karimifar M, Tahmasebi A, Bonakdar Z, Purajam S. Correlation of serum prolactin levels and disease activity in systematic lupus erythematosus. Rheumatology International 2013; 33:511-6.

26. Rezaieyazdi Z, Hesamifard A. Correlation between serum prolactin levels and lupus activity. Rheumatology International 2006; 26:1036-9.

27. Orbach H, Zandman-Goddard G, Amital H, Barak V, Szekanecz Z, Szucs G, Danko K, Nagy E, Csepany T, Carvalho JF, Doria A, Shoenfeld Y. Novel Biomarkers in Autoimmune Diseases. Ann N Y Acad Sci 2007; 1109:385-400.

28. Qian Q, Liuqin L, Hao L, Shiwen Y, Zhongping Z, Dongying C, Fan L, Hanshi X, Xiuyan Y, Yujin Y. The Effects of Bromocriptine on Preventing Postpartum Flare in Systemic Lupus Erythematosus Patients from South China. J Immunol Res 2015; 2015:6.

29. Bole-Feysot C, Goffin V, Edery M, Binart N, Kelly PA. Prolactin (PRL) and Its Receptor: Actions, Signal Transduction Pathways and Phenotypes Observed in PRL Receptor Knockout Mice. Endocr Rev 1998; 19:225-68.

30. Dagil R, Knudsen Maiken J, Olsen Johan G, O’Shea C, Franzmann M, Goffin V, Teilum K, Breinholt J, Kragelund Birthe B. The WSXWS Motif in Cytokine Receptors Is a Molecular Switch Involved in Receptor Activation: Insight from Structures of the Prolactin Receptor. Structure 2012; 20:270-82.

31. Hu Z-Z, Meng J, Dufau ML. Isolation and Characterization of Two Novel Forms of the Human Prolactin Receptor Generated by Alternative Splicing of a Newly Identified Exon 11. J Biol Chem 2001; 276:41086-94.

32. Goffin V, Martial JA, Summers NL. Use of a model to understand prolactin and growth hormone specificities. Protein Eng 1995; 8:1215-31.

33. Qazi AM, Tsai-Morris C-H, Dufau ML. Ligand-Independent Homo- and Heterodimerization of Human Prolactin Receptor Variants: Inhibitory Action of the Short Forms by Heterodimerization. Mol Endocrinol 2006; 20:1912-23.

34. Kline JB, Clevenger CV. Identification and Characterization of the Prolactin-binding Protein in Human Serum and Milk. J Biol Chem 2001; 276:24760-6.

35. Varas SM, Jahn GA. The Expression of Estrogen, Prolactin, and Progesterone Receptors in Mammary Gland and Liver of Female Rats During Pregnancy and Early Postpartum: Regulation by Thyroid Hormones. Endocr Res 2005; 31:357-70.

36. Jahn GA, Daniel N, Jolivet G, Belair L, Bole-Feysot C, Kelly PA, Djiane J. In vivo study of prolactin (PRL) intracellular signalling during lactogenesis in the rat: JAK/STAT pathway is activated by PRL in the mammary gland but not in the liver. Biol Reprod 1997; 57:894-900.

37. Clarke DL, Arey BJ, Linzer DI. Prolactin receptor messenger ribonucleic acid expression in the ovary during the rat estrous cycle. Endocrinology 1993; 133:2594-603.

38. Nagano M, Kelly PA. Tissue distribution and regulation of rat prolactin receptor gene expression. Quantitative analysis by polymerase chain reaction. J Biol Chem 1994; 269:13337-45.

39. Dorshkind K, Horseman ND. The Roles of Prolactin, Growth Hormone, Insulin-Like Growth Factor-I, and Thyroid Hormones in Lymphocyte Development and Function: Insights from Genetic Models of Hormone and Hormone Receptor Deficiency. Endocr Rev 2000; 21:292-312.

40. Urtishak SL, Mckenna EA, Mastro AM. Prolactin and Prolactin Receptor Expression in Rat, Small Intestine, Intraepithelial Lymphocytes During Neonatal Developmen. Dev Immunol 2001; 8.

41. Sangeeta Devi Y, Halperin J. Reproductive actions of prolactin mediated through short and long receptor isoforms. Mol Cell Endocrinol 2014; 382:400-10.

42. Moulton V, Tsokos G. T cell signaling abnormalities contribute to aberrant immune cell function and autoimmunity. J Clin Invest 2015; 125:2220-7.

43. Trentin F, Zucchi D, Signorini V, Elefante E, Bortoluzzi A, Tani C. One year in review 2021: systemic lupus erythematosus. Clin Exp Rheumatol 2021; 39:231-41.

44. Soliman S, Mohan C. Lupus nephritis biomarkers. Clin Immunol 2017; 185:10-20.

45. Legorreta-Haquet MV, Chávez-Rueda K, Chávez-Sánchez L, Cervera-Castillo H, Zenteno-Galindo E, Barile-Fabris L, Burgos-Vargas R, Álvarez-Hernández E, Blanco-Favela F. Function of Treg Cells Decreased in Patients With Systemic Lupus Erythematosus Due To the Effect of Prolactin. Medicine (Baltimore) 2016; 95:e2384.

Resumen 

La identificación de nuevos mecanismos moleculares involucrados en el desarrollo de enfermedades autoinmunes permitirá elaborar nuevas herramientas clínicas para un correcto diganóstico y seguimiento junto con el diseño de terapias personalizadas que sean más efectivas, que reduzcan la respuesta autorreactiva y resguarden la competencia del sistema inmune. La alta incidencia de enfermedades autoinmunes sobre el sexo femenino, especialmente Lupus Eritematoso Sistémico (LES) indica fuertemente que, siendo las hormonas femeninas un factor clave en la diferenciación fenotípica de los diferentes géneros cromosómicos, éstas podrían estar involucradas en los mecanismos autoinmunes subyacentes y ser un factor de riesgo considerable. Diversos estudios indican que existe una asociación entre hiperprolactinemia y LES sugiriendo así un rol importante de prolactina (PRL) en estos trastornos. Las acciones de PRL están mediadas por su receptor (PRL-R) que puede tener diferentes isoformas incluyendo una isoforma larga (PRL-RL) activadora formada por un dominio extracelular, uno transmembrana y uno transductor de señales intracelulares. La isoforma corta (del inglés “Short 1 b” PRL-RS1b) carece del dominio citoplasmático y por consiguiente no posee señalización intracelular. Las isoformas PRL-RS1b y PRL-RL se encuentran co-expresadas en diferentes tejidos incluyendo órganos linfáticos. Aunque la regulación de las diferentes isoformas del PRL-R ha sido estudiada extensivamente en el tracto reproductor femenino, su expresión en células del sistema inmune es indiscutiblemente desconocida. Debido a que alteraciones en la activación de linfocitos T podrían contribuir al desarrollo de autoinmunidad, la identificación de nuevos blancos terapéuticos relacionados con estas células es de vital importancia para el diseño de nuevas terapias y marcadores pronósticos de la enfermedad. Con estos antecedentes, el objetivo de nuestro trabajo fue evaluar el potencial del estudio de la expresión de ARNm del PRL-R en la enfermedad lúpica enrolando pacientes femeninos en distintas fases de la enfermedad. En este trabajo evaluamos mediante PCR en tiempo real la expresión de ARNm de las diferentes isoformas del PRL-R en células inmunes de sangre periférica de pacientes lúpicos del sexo femenino. Además, correlacionamos los valores obtenidos de la expresión del PRL-R con la severidad de la enfermedad. Logramos identificar exitosamente la presencia de PRL-RS1b y PRL-RL en las muestras de pacientes e individuos saludables. Sin embargo, la abundancia de ARNm de ambas isoformas no resultó en diferencias significativas entre pacientes e individuos saludables del grupo control. Los datos arrojados en este proyecto contribuyen a la comprensión de las interacciones entre el sistema inmune y endócrino en la salud y en la enfermedad en donde nuestro aporte indica que los niveles de PRL-R no cambiarían sustancialmente en la enfermedad lúpica. Además, el éxito del proyecto a largo plazo también contribuirá a la salud pública con el desarrollo de nuevos conocimientos sobre una descripción molecular del PRL-R enfocado en la prognosis de LES.

Objetivo general 

Evaluar el estudio del ARNm de las isoformas del PRL-R como herramienta clínica para el seguimiento y prognosis de LES.

Teniendo en cuenta que aún no se han desarrollado terapias completamente eficientes y junto con la necesidad de mejorar las herramientas clínicas para el tratamiento de trastornos autoinmunes nos proponemos desarrollar los siguientes objetivos específicos:

Objetivo específico 1.

Estudiar la expresión ex vivo de ARNm de las diferentes isoformas del PRL-R en células del sistema inmune de pacientes con Lupus Eritematoso Sistémico, obtenidas de sangre periférica

Objetivo específico 2.

Evaluar y correlacionar los niveles de expresión de ambas isoformas del receptor de prolactina con la severidad de la enfermedad.

Hipótesis:

La expresión de ARNm de las isoformas del PRL-R en células del sistema inmune de pacientes con LES presenta diferencias en sus niveles de expresión comparados con individuos sanos.

Materiales y métodos

Pacientes

Para el desarrollo de los objetivos específicos se reclutaron individuos pertenecientes a un grupo control y un grupo LES según las siguientes especificaciones de inclusión:

Grupo control: compuesto por 5 pacientes control. Los mismos serán pacientes sanos, de sexo femenino. Con edades comprendidas entre los 20 y los 65 años. Sin enfermedades conocidas y que no estén realizando ningún tratamiento farmacológico. Se excluyeron mujeres embarazadas, menopaúsicas o en periodo de lactancia.

Grupo LES: compuesto por 9 pacientes con LES, de sexo femenino, que asisten al servicio de reumatología y enrolados por médicos pertenecientes al Instituto de Inmunologia del Hospital Central de Mendoza.

Criterios de Inclusión para grupo LES:

1. Mayores de 18 años y menores de 65 años

2. Pacientes que cumplan con los criterios revisados del American College of Rheumatology para el diagnóstico del Lupus Eritematoso Sistémico y Artritis Reumatoide

3. Pacientes que a criterio del reumatólogo tratante tenga enfermedad “clínicamente estable” que haga poco probable la necesidad de ajuste de dosis de esteroides o cualquier inicio de un nuevo tratamiento inmunosupresor durante el curso del estudio o ambos

4. Inicio de la enfermedad al menos 6 meses antes de la inclusión en el estudio

5. Enfermedad activa con SLEDAI-2k >= 6

6. Uso de hidroxicloroquina dosis estable por 3 meses

7. Uso de micofenolato o Azatioprina o metotrexate estable

8. En el caso de mujeres en edad fértil se consultará sobre el uso de método anticonceptivo.

Criterios de Exclusión para grupo LES:

1. Diagnóstico concomitante de otra enfermedad autoinmune como, pero no exclusivamente, Esclerosis Múltiple, Diabetes Mellitus tipo 1, Esclerodermia, Artritis Idiopática Juvenil

2. Diagnóstico concomitante de alguna enfermedad crónica como, pero no exclusivamente, Diabetes Mellitus tipo 2, Insuficiencia Renal Crónica, Cirrosis Hepática, Síndrome de Inmunodeficiencia Adquirida, tumores sólidos y/o neoplasias hematológicas, Insuficiencia Cardiaca, Limitación Crónica del Flujo Aéreo

3. Embarazo o intención de embarazo en el año del estudio

4. Manifestaciones de enfermedad que a juicio del los investigadores sean graves y hagan que sea inapropiado el ingreso al estudio. Ejemplos: vasculitis del sistema nervioso central, psicosis lúpica, nefritis lúpica activa, trombocitopenia < 50.000, Hb< 8 gr/dL Leucopenia <3000, linfopenia< 400

5. Manifestaciones de enfermedad que amenacen la vida

6. Uso de dosis de prednisona> 30 mg diarios

7. Uso de terapia biológica en los 6 meses previos a la visita basal. Se excluye la ciclosporina, clorambucil, ciclofosfamida en los 6 meses anteriores

8. Infecciones graves (uso de antibióticos iv, oportunistas, tuberculosis latente, herpes zoster) seis meses antes de la visita basal

9. Niveles de Inmunoglobulinas plasmáticas bajo lo normal

10. Pruebas hepáticas > 3 veces el normal. Electrocardiograma anormal o radiografía de tórax anormal

11. Uso de terapia anticoagulante o síndrome antifosfolipidos asociado con LES

12. Haber recibido vacunas a virus atenuado durante el último año

13. Tener VIH, VHB y/o VHC

Bioética y bioseguridad

Los pacientes fueron comunicados de forma simple sobre el estudio para asegurar su correcta comprensión. Se les ha informado sobre la utilización de los datos del estudio y han firmado un consentimiento informado en forma individual. Los protocolos y el documento consentimiento informado desarrollados en el presente proyecto se encuentran aprobados por el comité de bioética de la Facultad de Ciencias Médicas de la UNCuyo y el comité de docencia e investigación del Hospital Central Mendoza. De la misma manera, todas los mecanismos de procesamiento de las muestras cuentan con estricta supervisión de protocolos de bioseguridad.

Obtención de células mononucleares de sangre periférica

Se obtuvo 20 mL de sangre periférica anticoagulada con EDTA. Se separaron células mononucleares de sangre periférica (PBMC en inglés) por el método de Ficoll-Hypaque convencional. La sangre obtenida fue diluida a la mitad con solución fisiológica estéril obteniendo una suspensión celular de 40 mL. Posteriormente, 10 mL de sangre fue vertida suavemente sobre 3 mL de Ficoll-Hypaque colocado previamente en un tubo cónico estéril de 15 mL. Este procedimiento se realizó en 4 tubos en forma simultánea. Posteriormente, los tubos fueron centrifugados por 20 min a 1800 rpm a temperatura ambiente. Al finalizar, la células mononucleares se encuentran en una capa intermedia del tubo de 15 mL. Estas células son aspiradas en forma cuidadosa mediante la utilización de pipetas pasteur estériles de 3 mL y depositadas en un tubo nuevo de 15ml. Las células obtenidas son lavadas con solución fisiológica y centrifugadas para descartar los residuos del Ficoll-Hypaque. De esta manera se obtienen aproximadamente 4*106 células/mm3.

ARN y ADNc

Las células obtenidas fueron procesadas para obtener y purificar ARN utilizando el reactivo de TRIZOL (Invitrogen). Esta técnica se fundamenta en una primera extracción con solvente orgánico y luego su precipitación con isopropanol. Posteriormente 2 microgramos de ARN total fueron utilizados para sintetizar ADNc utilizando la enzima MMLV transcriptasa reversa y oligodT como primers específicos para ARNm (poli A) totales según las especificaciones de reacción del comerciante.

PCR en Tiempo Real

Se realizaron ensayos de PCR en tiempo real para la cuantificación de mRNA de las diferentes isoformas del PRL-R. Los mismos se llevaron a cabo en el equipo Corbett 6000 (Quiagen, Inc) utilizando tres réplicas técnicas por cada muestra ensayada). La abundancia de los niveles de expresión de ARNm se realizó mediante el análisis de 2(-ΔΔCt) utilizado ampliamente para una comparación de abundancia de ARNm entre dos grupos utilizando como gen de referencia (o housekeeping gene) al gen de actina. Las secuencias utilizadas fueron: ACTINA humana Fw AAAGACCTGTACGCCAACAC y Rv GTCATACTCCTGCTTGCTGAT; PRL-RL Fw CCTTGTCCAGGTTCGCTGCAAA y Rv AGATGAGCATCAAATCCTTTTA; PRL-R1b (corto) Fw TAAATGGTCTCCACCTACCCTGAT y Rv CACCTCCAACAGATGAGCATCAAATCC. Los ciclos utilizados fueron de 3 pasos utilizando 95° 30seg-60° 30seg-72° 30seg en los 3 genes estudiados. Los productos generados por las PCR fueron secuenciados previamente para corroborar la identidad de los mismos y que correspondan específicamente con las secuencias del PRL-R. Los datos obtenidos fueron analizados con el programa GraphPad y Microsoft Excel.

Marco teórico del tema en estudio y antecedentes

Durante muchos años se han reportado numerosos avances en relación a los mecanismos patogénicos de las enfermedades autoinmunes 1, 2. Sin embargo, aún no se han desarrollado terapias específicas y eficaces para trastornos autoinmunes sistémicos como el Lupus Eritematoso Sistémico (LES) o Artritis Reumatoide (AR)3, 4. La gran heterogeneidad que rodea todos los ámbitos de las enfermedades autoinmunes como su prognosis, diagnóstico, tratamiento y etiología perjudica el desarrollo de nuevas terapias 5. A pesar de numerosos esfuerzos enfocados en la búsqueda de terapias más eficaces para las enfermedades autoinmunes sistémicas, la mayoría de las terapias actuales se fundamentan en la administración de drogas inmunosupresoras conduciendo a una supresión generalizada que puede llevar a severas complicaciones 6. Debido a esto, es crucial identificar mecanismos patogénicos en el desarrollo de autoinmunidad en forma individualizada así permitiendo diseñar terapias inmunosupresoras personalizadas que resguarden la competencia del sistema inmune.

Actualmente, se postula que múltiples factores intervienen en el desencadenamiento de las enfermedades autoinmunes incluyendo componentes genéticos, ambientales, infecciosos y hormonales que confieren una mayor susceptibilidad o mayor riesgo pero no aseguran su desarrollo 7-9. La alta incidencia de enfermedades autoinmunes sobre el sexo femenino respecto del masculino sugiere que la homeostasis hormonal del género femenino es un factor de riesgo muy importante 10. 

En los últimos años se ha avanzado mucho en el conocimiento del rol modulador de PRL sobre el sistema inmune 11-13. Se ha realizado aportes científicos sobre el rol de PRL en la regulación del sistema inmune demostrando que niveles de PRL disminuidos durante la lactancia disminuyen la cantidad de linfocitos T presentes en glándula mamaria 14. 

Estudios indican que en el timo PRL tendría un rol sobre la diferenciación de linfocitos T promoviendo la sobrevida de timocitos CD4-CD8- y su diferenciación a timocitos CD4+CD8+15. PRL participa en la activación de linfocitos T, principalmente incrementando su intensidad 16, 17, y aumentando la respuesta proliferativa de linfocitos T frente a mitógenos como así también la producción de IL-2 18.

Adicionalmente, PRL posee efectos antiapoptóticos sobre linfocitos B con un aumento en la producción de anticuerpos 12, 19. En células dendríticas, PRL aumenta la expresión de MHCII y CD40, y la producción de IL6 e IL12, promoviendo así su capacidad estimuladora de linfocitos T 20. 

La síntesis y secreción principal de PRL es un proceso complejo que se produce en las células lactotropas de la glándula pituitaria anterior (o hipófisis), y que está bajo el control de múltiples factores estimuladores e inhibidores 21. La dopamina secretada por neuronas hipotalámicas es el principal regulador negativo de la secreción de PRL pituitaria, actuando sobre el receptor de dopamina D2 en la membrana de las células lactotropas 22. PRL ejerce un efecto de retroalimentación negativa indirecta sobre su propia secreción actuando sobre neuronas hipotalámicas dopaminérgicas 21. Se ha demostrado también que PRL puede producirse en numerosos tejidos extrapituitarios, tales como decidua, glándula mamaria, ovario, próstata, testículo, linfocitos, células endoteliales, cerebro, piel, folículos pilosos, tejido adiposo y cóclea pero su función a estos niveles todavía no está bien esclarecida 21-23.

Se ha reportado una asociación entre hiperprolactinemia (hiperPRL) y enfermedades autoinmunes sistémicas (LES y AR), como así también con enfermedades autoinmunes específicas de órgano (Diabetes Mellitus tipo I, Tiroiditis de Hashimoto y Esclerosis Múltiple) 24-27. Para el caso de LES, estudios pre-clínicos indican que una hiperPRL se correlacionaría con el grado de actividad de la enfermedad y con títulos elevados de autoanticuerpos 26; sin embargo otros estudios no lograron encontrar la misma asociación 25. En cambio, en modelos animales de LES se observó una correlación marcada entre los niveles de PRL circulante y la severidad de la enfermedad 11, 19. Estudios pre-clínicos han reportado que el tratamiento con inhibidores de la liberación de PRL disminuye el número de recaídas en pacientes con LES, sugiriendo así un rol importante de PRL en el desarrollo de autoinmunidad28. Los mecanismos por los cuales una hiperPRL se asociaría al desarrollo de autoinmunidad no se conocen claramente y por ello es importante avanzar en el estudio de los efectos de PRL sobre linfocitos T.

Las acciones de PRL están mediadas por su receptor 29, el cual está formado por un dominio extracelular, un dominio transmembrana y un dominio transductor de señales intracelular altamente conservado entre especies 30. El gen del PRL-R contiene diferentes exones que por empalmes alternativos pueden generar diversas isoformas. Estas isoformas poseen un dominio extracelular idéntico, pero difieren en el tamaño y la secuencia de la porción intracelular, que puede ser corta, larga o intermedia presentando algunas diferencias entre humano y murino 31. La isoforma corta del PRL-R (PRL-RC) carece del dominio citoplasmático y por consiguiente no posee señalización intracelular 31. La isoforma larga del PRL-R (PRL-RL) se dimeriza en forma constitutiva y luego de la unión de una sola molécula del ligando (PRL) transmite una señal a través de proteínas citoplasmáticas asociadas 32. Por otro lado, heterodímeros de PRL-RL y PRL-RS1b son funcionalmente inactivos y no pueden conducir la transmisión de señales 33. Además de las diferentes isoformas unidas a la membrana, podemos encontrar una isoforma soluble del PRL-R (PRL-RS) constituida por la porción extracelular 34.

En la lactogénesis, el señalamiento del PRL-RL en glándula mamaria e hígado es diferente. De forma similar, la expresión de ARNm del PRL-RL se encuentra regulado de manera diferencial entre hígado y glándula mamaria 35, 36.

Las isoformas PRL-RC y PRL-RL se encuentran co-expresadas en diferentes tejidos incluyendo órganos linfáticos como timo y bazo, siendo la isoforma PRL-RL la más expresada 37, 38. Utilizando anticuerpos contra el dominio extracelular del PRL-R que se unen a ambas isoformas indistintamente, se ha demostrado que monocitos, macrófagos, células dendríticas, linfocitos T CD4+, T CD8+, Tγδ, linfocitos B, NK, granulocitos y células epiteliales tímicas expresan el PRL-R 15, 38-40. La regulación de las diferentes isoformas del PRL-R y su activación han sido estudiadas principalmente en el tracto reproductor femenino y glándula mamaria 41, estando reguladas por mecanismos endócrinos, parácrinos y autócrinos mediados por hormonas del ciclo ovárico 37. Por el contrario, la modulación de PRL-RL y PRL-RS1b en linfocitos T durante enfermedades autoinmunes es completamente desconocida. Debido a que alteraciones en la activación y señalización de linfocitos T puedan contribuir al desarrollo de enfermedades autoinmunes, la identificación de nuevos blancos terapéuticos linfocitarios es de vital importancia para el diseño de tratamientos eficaces como así también la generación de nuevos marcadores pronósticos de la enfermedad 42.

Se podría especular entonces que debido a fallas en la regulación de la expresión del PRL-RS1b, el cual carece de señalamiento, conduciría a un menor efecto sobre la modulación de la activación mediada por PRL y PRL-RL durante la activación de linfocitos T. En individuos susceptibles, estas fallas en la regulación podrían favorecer el inicio y la progresión de patologías autoinmunes. Por el contrario, la inducción farmacológica del PRL-RS1b podría suprimir respuestas inflamatorias exacerbadas siendo una potencial estrategia terapéutica para las enfermedades autoinmunes.

Resultados

Para evaluar la expresión de ARNm de las dos isoformas principales del PRL-R en células inmunes de pacientes autoinmunes y valuar su potencial uso como biomarcador, iniciamos un estudio clínico descriptivo no intervencionista. Enrolamos a pacientes mujeres con LES y mujeres saludables. No se incluyeron hombres en el estudio. Se obtuvieron 14 muestras de sangre periférica, donde 5 pertenecieron a mujeres saludables denominado grupo control; y 9 muestras provenientes de pacientes con LES. La totalidad de las muestras corresponde al sexo femenino. La edad promedio de las mujeres que conformaron el grupo de pacientes con LES fue de 31 años, con un límite superior de 41 años y un límite inferior de 19 años (Tabla 1). La duración de la enfermedad al momento de la toma de muestra fue en promedio de 5,1 años. En cuanto a las manifestaciones clínicas de la enfermedad dentro del grupo estudiado ningún paciente presentaba fiebre, mialgias, miositis, disminución de peso o úlceras orales. En la figura número 1 se observa el porcentaje de pacientes con las principales manifestaciones clínicas presentes en LES.

En base a los datos clínicos obtenidos podemos concluir que nuestra población en estudio se comporta de forma similar a lo reportado por numerosos estudios donde la heterogeneidad clínica es muy marcada 43. 

De forma similar, los parámetros de laboratorio de los pacientes con LES también fueron similares a lo reportado previamente al momento de la extracción de la muestra 44. La figura 2 muestra el porcentaje de pacientes con cada una de las principales alteraciones bioquímicas. La totalidad de los pacientes presentaba Anticuerpos anti-nucleares (ANA) positivos. Si bien un pequeño porcentaje presentaba proteinuria, no presentaban alteraciones del índice de filtrado glomerular al momento del estudio.

Teniendo en cuenta que nuestra cohorte de pacientes se comportaba de una manera esperada se procedió a continuar con los análisis de ARNm específico para PRL-R. 

Posteriormente evaluamos la expresión de ARNm de las diferentes isoformas del PRL-R por PCR en tiempo real en las muestras de PBMC de nuestra cohorte de pacientes con Lupus siguiendo los protocolos descriptos en materiales y métodos. Los resultados obtenidos indican que PBMC expresan ambas isoformas del PRL-RL y S1b, y que éstas se pueden cuantificar exitosamente como se puede observar en la figura 3 donde se evidencian las curvas de amplificación de PRL-RL.

Al analizar la expresión de las diferentes isoformas del PRL-R no se evidencian diferencias significativas entre las medias de los pacientes con LES en comparación con las mujeres saludables encontradas en el grupo control. 

A continuación se presenta una tabla con las medidas estadísticas más importantes obtenidas del procesamiento de los datos de la expresión de ambas isoformas del PRL-R en células PBMC en los dos grupos de pacientes estudiados.

Posteriormente se determinó si la expresión de las isoformas del PRL-R se asocia con la actividad de la enfermedad y su duración para así evaluar su potencial como biomarcador en la prognosis y tratamiento de LES. Determinamos mediante un análisis de correlación de Spearman entre la expresión de PRL-RL (Figura 4 A y D), o PRL-RS1b (Figura 4 B y E), o PRL-RL/PRL-RS1b (Figura 4 C y F), y la actividad utilizando el índice SLEDAI, o duración de la enfermedad. Como se puede observar en la figura 5, no logramos identificar ninguna correlación estadísticamente significativa (r>0,69; p>0,05). Se evidencian tendencias positivas entre los niveles de las diferentes isoformas, actividad y duración.

Por el contrario a lo que habíamos evidenciado sobre un aumento en la razón PRL-RL/PRL-RS1b en los pacientes con LES respecto al grupo control, este índice no mostró correlación alguna con SLEDAI y duración (Figura 4 C y F). Con este análisis podemos llegar a la conclusión de que no existe evidencia muestral suficiente para demostrar una asociación entre la expresión relativa de las distintas isoformas del PRLR con la duración de la enfermedad en pacientes con LES. La figura número 5, lo demuestra gráficamente.

Discusión

Los presentes resultados demuestran que células inmunes de sangre periférica expresan transcriptos de PRL-RL y PRL-RS1b y que éstos se pueden cuantificar exitosamente. Estos hallazgos son similares a reportes de los últimos años donde se demuestra la expresión de PRL-RL en células inmunes 45. Sin embargo, la expresión de la isoforma corta en células inmunes todavía es un tema de debate. Para nuestro conocimiento, este es un resultado inédito donde logramos cuantificar de manera exitosa los niveles de ARNm del PRL-RS1b. Sin embargo, no se encontró una correlación entre la expresión de las diferentes isoformas y la actividad de la enfermedad o el tiempo de duración de la misma. Esto último es un hallazgo original que ayudará a comprender la regulación de la transcripción de genes relacionados con el sistema PRL / PRL-R y su impacto en la sintomatología del lupus.

En nuestro trabajo demostramos que PBMC provenientes de nuestro grupo de pacientes con LES no presenta diferencias en la expresión de ARNm de PRL-RL, o PRL-RS1b, comparado con mujeres saludables. Por el contrario, está reportado que Linfocitos T efectores de pacientes con LES presentan diferencias en la expresión de PRL-RL comparado con individuos saludables 45. Esta falta de concordancia entre nuestro trabajo y la de Legorreta y col (2016) podría deberse a la utilización de diferentes muestras. En nuestro caso utilizamos células mononucleares que incluyen linfocitos (B, T, Treg y NK) y monocitos, mientras que en el trabajo citado utilizan linfocitos T efectores purificados. Sin embargo, la utilización de un índice PRL-RL/PRL-RS1b para identificar posibles alteraciones en el sistema PRL - PRL-R en muestras de pacientes con LES podría ser utilizado en el futuro.

Legorreta y col también evidenciaron que los niveles de PRL-RL están asociados a la severidad de la enfermedad45. Por el contrario, en nuestro trabajo no logramos identificar una correlación entre los niveles de PRL-RL, o PRL-RS1b, y la severidad de la enfermedad. Sin embargo se observa una tendencia positiva entre los niveles de PRL-RL, como así también de PRL-RS1b, con la actividad de la enfermedad simulando lo observado por Legorreta (2016). La falta de significancia estadística podría deberse a que nuestra cohorte de pacientes es más pequeño que el descripto por Legorreta 45. Adicionalmente evaluamos la correlación entre PRL-RL, PRL-RS1b y la duración de la enfermedad. De forma similar a lo observado con el SLEDAI, no se encontró correlación alguna.

Conclusiones

Para nuestro conocimiento, este es el primer reporte donde se evalúa una correlación entre PRL-RS1b, SLEDAI y duración. De forma similar, el estudio de la expresión de las isoformas del PRL-R en las diferentes poblaciones linfocitarias purificadas es crucial para continuar con nuestro estudio. En resumen, los datos que nacen de nuestro estudio no evidencian una gran ventaja en la utilización del estudio de las diferentes isoformas del PRL-R como marcador de LES. Sin embargo, la utilización del índice PRL-RL/PRL-RS1b podría colaborar en una futura clasificación detallada de los pacientes con LES aunque en este estudio no logramos asociar la expresión de las isoformas con parámetros clínicos de la enfermedad. El estudio de la expresión de PRL-R como así también parámetros epigenéticos relacionados a la regulación de su transcripción en poblaciones leucocitarias purificadas podría resultar más eficiente y clínicamente relevante.

 

 

CERRAR
BIODIAGNOSTICO
MANLAB
fba
» Abrir toda la revista
Bioquímica Molecular +-
Diagnóstico Clínico Aplicado +- Gestión de la Calidad +- Actualidad +- Bioresearch +- Novedades CUBRA +- Agenda de formación continua y posgrado »